View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14483_high_22 (Length: 378)
Name: NF14483_high_22
Description: NF14483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14483_high_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 340; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 340; E-Value: 0
Query Start/End: Original strand, 11 - 362
Target Start/End: Original strand, 38396366 - 38396717
Alignment:
| Q |
11 |
ttatacttgtctatttatatgagtaggctgtgcataatttatcaaatataacatttagtgtacttgctttaatttgttttcctattaggagtttaaatct |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38396366 |
ttatacttgtctatttatatgagtaggctgtgcataatttatcaaatatagtatttagtgtacttgctttaatttgttttcctattaggagtttaaatct |
38396465 |
T |
|
| Q |
111 |
gactgtattgatatctcaaacacacttcttaattgtgaaagaacacctgttcgtgtttaatgtcctttcgtcagcatgatggatacatggctgaaatgca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38396466 |
gactgtattgatatctcaaacacacttcttaattgtgaaagaacacctgttcgtgtttaatgtcctttcgtcagcatgatggatgcatggctgaaatgca |
38396565 |
T |
|
| Q |
211 |
tctttgtatgcacttgtggactgtggttagacacaattattttatgcaggtgctatcatggcagtgtaaatacaacacatgcatgttcgttggattcaat |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38396566 |
tctttgtatgcacttgtggactgtggttagacacaattattttatgcaggtgctatcatggcagtgtaaatacaacacatgcatgttcgttggattcaat |
38396665 |
T |
|
| Q |
311 |
atttccatccatctcttcattgctttggctttgatatatatgtattttgtat |
362 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38396666 |
atttccatccatctcttcattgctttggctttgatatatatgtattttgtat |
38396717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University