View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14483_high_44 (Length: 272)

Name: NF14483_high_44
Description: NF14483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14483_high_44
NF14483_high_44
[»] chr4 (1 HSPs)
chr4 (18-91)||(22444357-22444430)


Alignment Details
Target: chr4 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 18 - 91
Target Start/End: Complemental strand, 22444430 - 22444357
Alignment:
18 cattgtacacactaaatgcgaacacctctactaatcaaaatttgaaacttaactcccaaagttatgaaattcta 91  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
22444430 cattgtacacactaaatgcgaacaactctactaatcaaaatttgaaacttaactcccaaagttatgaaattcta 22444357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University