View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14483_high_44 (Length: 272)
Name: NF14483_high_44
Description: NF14483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14483_high_44 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 18 - 91
Target Start/End: Complemental strand, 22444430 - 22444357
Alignment:
| Q |
18 |
cattgtacacactaaatgcgaacacctctactaatcaaaatttgaaacttaactcccaaagttatgaaattcta |
91 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22444430 |
cattgtacacactaaatgcgaacaactctactaatcaaaatttgaaacttaactcccaaagttatgaaattcta |
22444357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University