View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14483_high_46 (Length: 256)

Name: NF14483_high_46
Description: NF14483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14483_high_46
NF14483_high_46
[»] chr3 (1 HSPs)
chr3 (185-236)||(8249710-8249761)


Alignment Details
Target: chr3 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 185 - 236
Target Start/End: Complemental strand, 8249761 - 8249710
Alignment:
185 tttcttccttgcatttatcctaatttggcctcctggagcattcttgttgagg 236  Q
    |||||||||||||||||||||||||||||||| |||||||||||| ||||||    
8249761 tttcttccttgcatttatcctaatttggcctcttggagcattcttattgagg 8249710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University