View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14483_high_58 (Length: 233)
Name: NF14483_high_58
Description: NF14483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14483_high_58 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 16 - 218
Target Start/End: Original strand, 36479796 - 36479998
Alignment:
| Q |
16 |
caaagaagacgtaactaatcaataatgaaacaaacatttgatgtgattggtgcctcaaagagataaatcttcaatttcaagctcaacggttgttggatgc |
115 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36479796 |
caaagaagacgtaactaatcaacaatgaaacaaacatttgatgtgattggtgcctcaaagagataaatcttcaatttcaagctcaacggttgttggatgc |
36479895 |
T |
|
| Q |
116 |
agttcaatccaaattcaacatccttaccaatacaactggccacttcatgaatccatgattatgccatagatgaaatccgtgaaaatggctatagcagttt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36479896 |
agttcaatccaaattcaacatccttaccaatacaactggccacttcatgaatccatgattatgccatagatgaaatccgtgaaaatggctatagcagttt |
36479995 |
T |
|
| Q |
216 |
cat |
218 |
Q |
| |
|
||| |
|
|
| T |
36479996 |
cat |
36479998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University