View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14483_high_59 (Length: 222)
Name: NF14483_high_59
Description: NF14483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14483_high_59 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 15 - 194
Target Start/End: Complemental strand, 37463855 - 37463676
Alignment:
| Q |
15 |
acagacctccctcttccatgaatatcatgtgtgtggacgttgttgtatcattcacagagaagtatgcctcccttttgtacctacgtgcaccctgttgata |
114 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37463855 |
acagacctccctcttccatgaatatcatgcgtgtggacgttgttgtatcattcagagagaagtatgcctcccttttgtacctacgtgcaccctgttgata |
37463756 |
T |
|
| Q |
115 |
ccttaaaccacgataaccctcgcctatgaatcttaatcacgaacccactacttgtcaaacttgtacaaaccaaaaccccc |
194 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37463755 |
ccttaaaccacgataaccctcacctatgaatcctaatcacgaacccactacttgtcaaacttgtacaaaccaaaaccccc |
37463676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University