View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14483_low_21 (Length: 391)
Name: NF14483_low_21
Description: NF14483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14483_low_21 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 101; Significance: 6e-50; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 1 - 105
Target Start/End: Complemental strand, 13655689 - 13655585
Alignment:
| Q |
1 |
agtagaagctcattcagatgcagaagaggatcttggaagtaatgatgatggcaaagttcttgcatgtgcagaacaaaaagaatgttcaacgagtgatggt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13655689 |
agtagaagctcattcagatgcagaagaggatcttgaaagtaatgatgatggcaaagttcttgcatgtgcagaacaaaaagaatgttcaacgagtgatggt |
13655590 |
T |
|
| Q |
101 |
caaag |
105 |
Q |
| |
|
||||| |
|
|
| T |
13655589 |
caaag |
13655585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 283 - 332
Target Start/End: Complemental strand, 13655418 - 13655369
Alignment:
| Q |
283 |
taagagttgatatttttaacacatttataattagtttagttatttccctc |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13655418 |
taagagttgatatttttaacacatttataattagtttagttatttccctc |
13655369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 285 - 326
Target Start/End: Complemental strand, 13660875 - 13660835
Alignment:
| Q |
285 |
agagttgatatttttaacacatttataattagtttagttatt |
326 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
13660875 |
agagttgatatttt-aacacatttataattagtttagttatt |
13660835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 342 - 380
Target Start/End: Complemental strand, 13655355 - 13655317
Alignment:
| Q |
342 |
aatagtttagttattacgactattttgaacaattaaaat |
380 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
13655355 |
aatagtttagttattatgactattttgaacaactaaaat |
13655317 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University