View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14483_low_37 (Length: 322)
Name: NF14483_low_37
Description: NF14483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14483_low_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 25 - 291
Target Start/End: Complemental strand, 23407812 - 23407544
Alignment:
| Q |
25 |
gaacttgaacccaaatctccgctgtgttcatttggataaccataggatcttcacctatagcaacgttctgcaagataatcttatttt-atcaattagtca |
123 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||| ||||||||||| ||| |||||| |||||||||||| |
|
|
| T |
23407812 |
gaacttgaacccaaatctccgttgtgttcatttggatagccataggatcttcacctatagcaaccttctgcaagatgatcatatttttatcaattagtca |
23407713 |
T |
 |
| Q |
124 |
aggacttccttgaaaaattctctcccgatcac-ttataaaaattgaaccatatacttattatcctccatagacattaaagtaatttttctccaagattgc |
222 |
Q |
| |
|
|| |||||| ||||||||||||||| |||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23407712 |
agtacttccatgaaaaattctctccagatcaccttataacaattgaaccatatacttattatcctccatagacattaaagtaatttttctccaagattgc |
23407613 |
T |
 |
| Q |
223 |
cacatgctccctagtctttcttcaatcgtacataggtgaaccagtttgttcaccaccaccctccctatg |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23407612 |
cacatgctccctagtctttcttcaatcgtacataggtgaaccagtttgttcaccaccaccctccctatg |
23407544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University