View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14483_low_40 (Length: 303)
Name: NF14483_low_40
Description: NF14483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14483_low_40 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 13 - 287
Target Start/End: Original strand, 38842964 - 38843234
Alignment:
| Q |
13 |
aatatgaagagcccttgatggtaaatttccatttgaatctttctcatcaggatcaaccatgttgagttgcttgatgatttctcttttaggatcagaaatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38842964 |
aatatgaagagcccttgatggtaaatttccatttgaatctttctcatcaggatcaaccatgttgagttgcttgatgatttctcttttaggatcagaaatt |
38843063 |
T |
|
| Q |
113 |
attggatagttcacctttgcacctggctgcatttacaattacaaacatatgaacaaacaagaatatgaaaattttggtgtgcatgcatgtggaaaatagg |
212 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38843064 |
attggatagttaacctttgcacctggctgcatttacaattacaaaaatat----caacaagaatatgaaaattttggtgtgcatgcatgtggaaaatagg |
38843159 |
T |
|
| Q |
213 |
aaaacttacggtatgtgcttcaatgtctttgatccactccttgtgagattcaagatcatcacaagacatacctaa |
287 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38843160 |
aaaacttacagtatgtgcttcaatgtctttgatccactccttgtgagattcaagatcatcacaagacatacctaa |
38843234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University