View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14483_low_41 (Length: 300)
Name: NF14483_low_41
Description: NF14483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14483_low_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 13 - 283
Target Start/End: Complemental strand, 2286420 - 2286150
Alignment:
| Q |
13 |
aatatctatagtgcccttgatagacttggcctagcaaagcaaattgaggtttcaactccacattcagaagctgtatttgccaattcatatccaccatctt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2286420 |
aatatctatagtgcccttgatagacttggcctagcaaagcaaattgaggtttcaactccacattcagaagctgtatttgccaattcatatccaccatctt |
2286321 |
T |
 |
| Q |
113 |
catgtacatttagggatgatataataccttacatgaaacctttacttgaannnnnnncacaaattggaacacctttttatattaatgcataccctttttt |
212 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2286320 |
catgtacatttagggatgatatagtaccttacatgaaacctttacttgaatttttttcacaaattggaacacctttttatattaatgcataccctttttt |
2286221 |
T |
 |
| Q |
213 |
ggcctataaaaatgaccctcaacatattgacataaactatgctttatttaagaaaaatcctggtatttatg |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2286220 |
ggcctataaaaatgaccctcaacatattgacataaactatgctttatttaagaaaaatcctggtatttatg |
2286150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University