View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14483_low_42 (Length: 298)
Name: NF14483_low_42
Description: NF14483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14483_low_42 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 5e-93; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 11 - 183
Target Start/End: Original strand, 15218720 - 15218892
Alignment:
| Q |
11 |
cagcacagataatgacttatggtggcatagaactgagttcacctactcttgcatctgcaatgcttaacctcattccagctttcacttttgtacttgcact |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15218720 |
cagcacagataatgacttatggtggcatagaactgagttcacctactcttgcatctgcaatgcttaacctcattccagctttcacttttgtacttgcact |
15218819 |
T |
 |
| Q |
111 |
gattttcaggttcctcatatgattattaaactttactaaaaggtgaattttatggaaaatatatttctaacac |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15218820 |
gattttcaggttcctcatatgattattaaactttactaaaaggtgaattttatggaaaatatatttctaacac |
15218892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 206 - 246
Target Start/End: Original strand, 15218916 - 15218956
Alignment:
| Q |
206 |
attagatgaaattcatatggatcccacattttgaaaatgga |
246 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
15218916 |
attagataaaactcatatggatcccacattttgaaaatgga |
15218956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University