View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14483_low_48 (Length: 256)
Name: NF14483_low_48
Description: NF14483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14483_low_48 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 185 - 236
Target Start/End: Complemental strand, 8249761 - 8249710
Alignment:
| Q |
185 |
tttcttccttgcatttatcctaatttggcctcctggagcattcttgttgagg |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
8249761 |
tttcttccttgcatttatcctaatttggcctcttggagcattcttattgagg |
8249710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University