View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14483_low_51 (Length: 250)
Name: NF14483_low_51
Description: NF14483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14483_low_51 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 232
Target Start/End: Original strand, 43173139 - 43173370
Alignment:
| Q |
1 |
tatgtagcacatactgggtggacatattacacagataaatttcaatgtaaacaaatattttagggactaaaaacaaagaaaagcttttataaggactaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43173139 |
tatgtagcacatactgggtggacatattacacagataaatttcaatgtaaacaaatattttagggactaaaaacaaagaaaagcttttataaggactaaa |
43173238 |
T |
 |
| Q |
101 |
tgtagtatatttggaggacaaataaacatatttaaagcctgtgtatatgaaccctttataataattgtgccgttgcctttcataaaacaggaggactctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43173239 |
tgtagtatatttggaggacaaataaacatatttaaagcctgtgtatatgaaccctttataataattgtgccgttacctttcataaaacaggaggactctg |
43173338 |
T |
 |
| Q |
201 |
attgggattgctctttgcacctaccactttgg |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
43173339 |
attgggattgctctttgcacctaccactttgg |
43173370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University