View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14483_low_52 (Length: 250)
Name: NF14483_low_52
Description: NF14483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14483_low_52 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 47042030 - 47042265
Alignment:
| Q |
1 |
tgcagcttatcatatgtctattagctgtttttagcttgttttcataagcactgcttacnnnnnnncttatagtttatatgnnnnnnnncttgactttatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| ||| ||||||||||| |||||||||||| |
|
|
| T |
47042030 |
tgcagcttatcatatgtctattagctgtttttagcttattttcataaccactgcttattaaaaaacttttagtttatatgaaaaaaaacttgactttatt |
47042129 |
T |
|
| Q |
101 |
ttatatgttggtatagaaatatcatataaatattcgcttatccaaacagaatctttgctgaacaaaagcattagtttacttttgtgataactatgatact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47042130 |
ttatatgttggtatagaaatatcatataaatattcgcttatccaaacagaatctttgctgaacaaaagcattagtttacttttgtgataactatgatact |
47042229 |
T |
|
| Q |
201 |
ctatttgtctatttggctgagcttattctcttatcc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
47042230 |
ctatttgtctatttggctgagcttattctcttatcc |
47042265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University