View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14483_low_56 (Length: 243)

Name: NF14483_low_56
Description: NF14483
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14483_low_56
NF14483_low_56
[»] chr7 (1 HSPs)
chr7 (20-227)||(38347845-38348052)


Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 20 - 227
Target Start/End: Complemental strand, 38348052 - 38347845
Alignment:
20 aaaggaggaatcataaagacataacccatcttgtgaaacagtgaatttaaaaggaaaggatttaacatgcagagtttggaagaaaaggaagaaattgaat 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38348052 aaaggaggaatcataaagacataacccatcttgtgaaacagtgaatttaaaaggaaaggatttaacatgcagagtttggaagaaaaggaagaaattgaat 38347953  T
120 tcgaaataaaaacagctaagaatgctataaagggaatagcagatgcatgatgattgatcaagaggagcgagctgtcttatagcaataggttagagtaaga 219  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38347952 tcaaaataaaaacagctaagaatgctataaagggaatagcagatgcatgatgattgatcaagaggagcgagctgtcttatagcaataggttagagtaaga 38347853  T
220 gtagtata 227  Q
    ||||||||    
38347852 gtagtata 38347845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University