View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14484_high_50 (Length: 325)
Name: NF14484_high_50
Description: NF14484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14484_high_50 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 116 - 310
Target Start/End: Complemental strand, 13922184 - 13921990
Alignment:
| Q |
116 |
tttattaattgactcacactcaaaataattaataataaagaactactactttatgctattaggagtggacagttactagagaaatgctggttgcttacaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
13922184 |
tttattaattgactcacactcaaaataattaataataaagaactactactttatgctattaggaatggacagttactagagaaatgctggttgcttacaa |
13922085 |
T |
 |
| Q |
216 |
attggtacatttctgccgaacttgttcgtatatgtctattgtccggtccattccaatggaaatgatatgtggtggggaagaggggacatgtcatt |
310 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13922084 |
attggtacatttctgccgaacttgttcatatatgtctattgtccggtccattccaatggaaatgatatgtggtggggaagaggggacatgtcatt |
13921990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 1 - 79
Target Start/End: Complemental strand, 13922521 - 13922443
Alignment:
| Q |
1 |
attgcaaaagcttcttatattaacttatcaccacttactatacctagtttgtcttattttcttttgaaggataaaccgt |
79 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
13922521 |
attgcaaaagcttattatattaacttatcaccacttactatacgtagtttgtcttattttcttttgaaggataaaccgt |
13922443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University