View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14484_high_51 (Length: 311)
Name: NF14484_high_51
Description: NF14484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14484_high_51 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 14 - 295
Target Start/End: Original strand, 28696319 - 28696597
Alignment:
| Q |
14 |
gaagggaacatgcagcaattctttatgtaatttttcttggtgggaaatgggcattcaaatggaaattttttg-ccgaatttcacatgcagctatttggtt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| ||||||| ||||||||| |
|
|
| T |
28696319 |
gaagggaacatgcagcaattctttatgtaatttttcttggtgggaaatgggcattcaaatggaaaatttttggccgaatttggcatgcagttatttggtt |
28696418 |
T |
|
| Q |
113 |
tataagggaatgtcataatcaagtaatattctctaatggtgannnnnnnnnnnagctatgtttggtctaattgagatcaatcaatgtctattttcggatt |
212 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||| || |||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
28696419 |
tataagggaatgtcgtaat--agtaatattctctaatggtgatttattttt--agttatgtttggtctaattgagatcgatcaatgtctattttccgatt |
28696514 |
T |
|
| Q |
213 |
ggtgtgtcgacctaattggctgtgtagggtttaatctgatattttctcttgcttggagttctggatctttctgtccatttttc |
295 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28696515 |
ggtgtgtcgacccaattggctgtgtagggtttaatctgatattttctcttgcttggagttctggatctttctgtccatttttc |
28696597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 201 - 295
Target Start/End: Complemental strand, 29020960 - 29020866
Alignment:
| Q |
201 |
tattttcggattggtgtgtcgacctaattggctgtgtagggtttaatctgatattttctcttgcttggagttctggatctttctgtccatttttc |
295 |
Q |
| |
|
||||| |||||||||||||||||| ||| |||||||||||||||||||| |||||||||||||||||||||| ||| ||||||||||| ||||| |
|
|
| T |
29020960 |
tatttccggattggtgtgtcgacccaatgggctgtgtagggtttaatctcatattttctcttgcttggagttatggcgctttctgtccagttttc |
29020866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 14 - 52
Target Start/End: Original strand, 28674104 - 28674142
Alignment:
| Q |
14 |
gaagggaacatgcagcaattctttatgtaatttttcttg |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28674104 |
gaagggaacatgcagcaattctttatgtaatttttcttg |
28674142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University