View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14484_high_53 (Length: 297)
Name: NF14484_high_53
Description: NF14484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14484_high_53 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 94; Significance: 7e-46; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 94; E-Value: 7e-46
Query Start/End: Original strand, 176 - 277
Target Start/End: Complemental strand, 33450766 - 33450665
Alignment:
| Q |
176 |
ggtctaggaagtatcgtctttataagtaacttatatttacttaaacaatttaattgctaacatcatctgcactgacatatgtaattaacacaccgcagag |
275 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33450766 |
ggtctaggaagtatcgtctttttaagtaacttatatttacttaagcaatttaattgctaacatcatctgcactgacatatgtaattaacacaccgcagag |
33450667 |
T |
|
| Q |
276 |
tt |
277 |
Q |
| |
|
|| |
|
|
| T |
33450666 |
tt |
33450665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 7 - 52
Target Start/End: Complemental strand, 33450935 - 33450890
Alignment:
| Q |
7 |
tccaagaatataaaaatcgactatatttaaatacaatgaataatta |
52 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33450935 |
tccaataatataaaaatcgactatatttaaatacaatgaataatta |
33450890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University