View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14484_high_60 (Length: 277)
Name: NF14484_high_60
Description: NF14484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14484_high_60 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 18 - 271
Target Start/End: Original strand, 37643698 - 37643958
Alignment:
| Q |
18 |
agatgccatcctttggttgtcatatagagtgatggtagttt-------gaagtagtttgaacaatacttatccttttggtttgagtttaggattaacact |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37643698 |
agatgccatcctttggttgtcatatagagtgatggtagactatgccctgaagtagtttgaacaatacttatccttttggtttgagtttaggattaacact |
37643797 |
T |
 |
| Q |
111 |
agctttggtgctaagcagaaatgtattccaagtgaggatactacacactcacatgaaaaaacaattcagatggcatcttttgagaggggggttggggtta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37643798 |
agctttggtgctaagcagaaatgtattccaagtgaggatactacacgctcacatgaaaaaacaattcagatggcatcttttgagaggggggttggggtta |
37643897 |
T |
 |
| Q |
211 |
gcacataatactttgaaatagatnnnnnnnnnttatctacttgtttctttaattcttctct |
271 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37643898 |
gcacataatactttgaaatagataaaaaaaaattatctacttgtttctttaattcttctct |
37643958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 61 - 122
Target Start/End: Original strand, 19826422 - 19826483
Alignment:
| Q |
61 |
agtagtttgaacaatacttatccttttggtttgagtttaggattaacactagctttggtgct |
122 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19826422 |
agtagtttgaacgatacttatccttgtggtttgagtttaggattaacactagctttgatgct |
19826483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University