View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14484_high_62 (Length: 262)
Name: NF14484_high_62
Description: NF14484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14484_high_62 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 6 - 209
Target Start/End: Complemental strand, 24987701 - 24987496
Alignment:
| Q |
6 |
gtcgaagaaaatatgtatgtgtttaaatttaatgttgatatgcaaaatagatcctctacatcacgcttaattgcacatctgatcataaatcgttagatta |
105 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24987701 |
gtcgaaaaaaatatgtatgtgtttaaatttaatgttgatatgcaaaatagatcctctacatcacgcttaattgcacatctgatcataaatcgttagatta |
24987602 |
T |
 |
| Q |
106 |
agagagggaaactctc--tagctatcctaatataacggtccaacctgcaccataaagaattcatggccgttcatttggggaaaaaatcaacggacatgtg |
203 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24987601 |
agagagggaaactctctatagctatcctaatataacggtccaacctgcaccataaagaattcatggccgttcatttggggaaaaaatcaacggacatgtg |
24987502 |
T |
 |
| Q |
204 |
gaacta |
209 |
Q |
| |
|
|||||| |
|
|
| T |
24987501 |
gaacta |
24987496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University