View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14484_high_67 (Length: 251)
Name: NF14484_high_67
Description: NF14484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14484_high_67 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 14 - 192
Target Start/End: Complemental strand, 8793809 - 8793630
Alignment:
| Q |
14 |
tatgttttgattaataagcaaattttaaacatatactcctgtctttaaataattataaagtaattgatagagaaagagtataactgat-nnnnnnntatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8793809 |
tatgttttgattaataagcaaattttaaacatatactcttgtcttttaataattataaagtaattgatagagaaagagtataactgataaaaaaaatatt |
8793710 |
T |
 |
| Q |
113 |
gtatataaaaaatcatgttgagagatatcgacctcttaaatgcatctcaatttatttagtactatgatgttaagaatgga |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8793709 |
atatataaaaaatcatgttgagagatatcgacctcttaaatgtatctcaatttatttagtactatgatgttaagagtgga |
8793630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University