View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14484_high_73 (Length: 230)
Name: NF14484_high_73
Description: NF14484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14484_high_73 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 22 - 212
Target Start/End: Original strand, 35599940 - 35600130
Alignment:
| Q |
22 |
atatacaagagattgcatctatatacaagtagattctcgctaatttcagttgtttggctccatccaccaaccaagaaaatctcactaatctactttataa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35599940 |
atatacaagagattgcatctatatacaagtagattctcgctaatttcagttgtttggctccatccaccaaccaagaaaatctcactaatctactttataa |
35600039 |
T |
 |
| Q |
122 |
attacgatgctttaccttgatatgtttgatcatacttcacaatctcaaacactagtattttaaatcaaaattcaatttttgatgagcagaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35600040 |
attacgatgctttaccttgatatgtttgatcatacttcacaatctcaaacactagtatgctaaatcaaaattcaatttttgatgagcagaa |
35600130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University