View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14484_high_79 (Length: 216)

Name: NF14484_high_79
Description: NF14484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14484_high_79
NF14484_high_79
[»] chr6 (1 HSPs)
chr6 (59-181)||(32616058-32616180)


Alignment Details
Target: chr6 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 59 - 181
Target Start/End: Original strand, 32616058 - 32616180
Alignment:
59 ttggtacacttcgtttgaatctaaaattatggattgaatctaaaatctattcttctattccataaatcgaaaatttgagtttaccaggttcttgaacata 158  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
32616058 ttggtacacttcgtttgaatctaaaattatggattgaatctaaaatctattcttctattctataaatcgaaaatttgagtttaccaggttcttgaacata 32616157  T
159 tatgaaaattttggactcaataa 181  Q
    |||||||||||||||||||||||    
32616158 tatgaaaattttggactcaataa 32616180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University