View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14484_high_81 (Length: 216)
Name: NF14484_high_81
Description: NF14484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14484_high_81 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 40 - 201
Target Start/End: Complemental strand, 14819684 - 14819523
Alignment:
| Q |
40 |
gagatatgtttttcgcaatacatggctgttgcatcttttcacgagtgaatccacgtccgaaataattaa-ttcagcttcgtgaaattttctgcatgtata |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14819684 |
gagatatgtttttcgcaatacatggctgttgcatctttttacgagtgaa-ccacgtccgaaataattaaattcagcttcgtgaaattttctgcatgtata |
14819586 |
T |
|
| Q |
139 |
caaaaagcatagatgcgtaaagctaaagcatacaataagaattttaatctataatagactttg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14819585 |
caaaaagcatagatgcgtaaagctaaagcataaaataagaattttaatctataatagactttg |
14819523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University