View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14484_high_87 (Length: 206)
Name: NF14484_high_87
Description: NF14484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14484_high_87 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 8 - 190
Target Start/End: Complemental strand, 7766738 - 7766556
Alignment:
| Q |
8 |
tgagatgaaaatacatgtacatatttcaaataaaagtgcaatttagaatactttcaatttgaaatttcatagaagttatacttcgacctttgcccgctac |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7766738 |
tgagaagaaaatacatgtacatatttcaaataaaagtgcaatttagaatattttcaatttgaaatttcatagaagttatacttcgacctttgcccgctac |
7766639 |
T |
 |
| Q |
108 |
ttatcactttatacaattttgtcattttaatccctgccctctcnnnnnnngttacagcgcagtgtaacaacaacacggtttga |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7766638 |
ttatcactttatacaattttgtcattttaatccctgccctctcaaaaaaagttacagcgcagtgtaacaacaacacggtttga |
7766556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University