View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14484_high_9 (Length: 586)
Name: NF14484_high_9
Description: NF14484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14484_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 58; Significance: 4e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 1 - 67
Target Start/End: Original strand, 33525845 - 33525913
Alignment:
| Q |
1 |
tcacattcaaggcaaaataaatta--cccatctgcaaccttcaaacccacattctaaatacaatcagac |
67 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33525845 |
tcacattcaaggcaaaataaattatacccatctgcaaccttcaaacccacattctaaatacaatcagac |
33525913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University