View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14484_low_30 (Length: 414)
Name: NF14484_low_30
Description: NF14484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14484_low_30 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 98; Significance: 4e-48; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 18 - 218
Target Start/End: Complemental strand, 2588235 - 2588048
Alignment:
| Q |
18 |
aatttggaaaaattgaagtatttatttgttgcgtacaatgacgataagaggtactagtagagtagtagtacacgtatacgaggcaacaagttcccagaag |
117 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2588235 |
aatttggaaaaattgaagtattt----gttgcgtacaatcacgataagagagactagtagagtagtagtacacgtatacgaggcaacaagttccgagaag |
2588140 |
T |
|
| Q |
118 |
aataagaatctatgnnnnnnnngtttatcacactcactcactcactcacatgcaatcatgcatacagctaactaactctgtagcatgcagttgatagtag |
217 |
Q |
| |
|
||| ||||| |||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2588139 |
aatcagaatgtatg-tttttttgtttatca--------cactcactcacatgcaatcatgcatacagctaactaactctgtagcatgcagttggtagtag |
2588049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 284 - 333
Target Start/End: Complemental strand, 2587985 - 2587936
Alignment:
| Q |
284 |
aacaacagagtcagcttttgtttaaatttaatcaaacaaacaccacacac |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2587985 |
aacaacagagtcagcttttgtttaaatttaatcaaacaaacaccacacac |
2587936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University