View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14484_low_38 (Length: 367)
Name: NF14484_low_38
Description: NF14484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14484_low_38 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 14 - 345
Target Start/End: Original strand, 5744056 - 5744387
Alignment:
| Q |
14 |
attattctcgcctcaatatgcgaatgcacgagaattttactattttgtgctnnnnnnnncatgcaacacttacgcatacatatgtgtatgcatgaacctc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5744056 |
attattctcgcctcaatatgcgaatgcacgagaattttactattttgtgctaaaaaaaacatgcaacacttacgcatacatatgtgtatgcatgaacctc |
5744155 |
T |
|
| Q |
114 |
acatgatacaaactaaatttcatgtgccttatgttaccatcctttgaagatctcttctataagtagagcaagagagaaatagtttatatattgatacata |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5744156 |
acatgatacaaactaaatttcatgtgccttatgttaccatcctttgaagatctcttctataagtagagcaagagagaaatagtttatatattgatacata |
5744255 |
T |
|
| Q |
214 |
ctctcatctttccaatttttccttctagtgttttattatctattgaaaatgacaatgaaacaaatgatttttgttatgtttttctcattcttttccctta |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5744256 |
ctctcatctttccaatttttccttctagtgttttattatctattgaaaatgacaatgaaacaaatgatttttgttatgtttttctcattcttttccctta |
5744355 |
T |
|
| Q |
314 |
acctcgtctccccaatctttacccttcccctt |
345 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |
|
|
| T |
5744356 |
acctcctctccccaatctttacccttcccctt |
5744387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University