View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14484_low_40 (Length: 357)
Name: NF14484_low_40
Description: NF14484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14484_low_40 |
 | |
|
| [»] chr4 (4 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 82 - 357
Target Start/End: Complemental strand, 5233185 - 5232906
Alignment:
| Q |
82 |
attgttgatgaaatatcttaatttttt---gtcaaaaaa-tactttgcaatctctttctagatttaacaaaagtttaaaattatgaccccccaatgacca |
177 |
Q |
| |
|
||||||||||||||| ||||||||| | ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5233185 |
attgttgatgaaatagcttaattttgtttggtcaaaaaaatactttgcaatctctttctagatttaacaaaagtttaaaattatgaccccccaatgacca |
5233086 |
T |
|
| Q |
178 |
tcttatatgtgcaatttctccatttacatatttgtgacacatgtaacacatagttttacataattgacatcttcatgtcacaaaaaagggtcttaaaatc |
277 |
Q |
| |
|
|||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5233085 |
tcttatatgtgcaatttctccatttagacatttgtgacacatgtaacacatagttttacataattgacatcttcatgtcacaaaaaagggtcttaaaatc |
5232986 |
T |
|
| Q |
278 |
ttaatttgtcacaacattgcaaagaatatttgattccaagtatcaggaacaccaggcaaacaccaatgtatgcaatcagc |
357 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
5232985 |
ttaatttgtcacaacattgcaaagaatatttgattccaagtatcaggaacaccaggcaaacaccaatgtatacaatcagc |
5232906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 296 - 354
Target Start/End: Original strand, 51877530 - 51877588
Alignment:
| Q |
296 |
gcaaagaatatttgattccaagtatcaggaacaccaggcaaacaccaatgtatgcaatc |
354 |
Q |
| |
|
||||||| |||| |||||| |||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
51877530 |
gcaaagagcatttcattccatgtatcaggaacaccaggcaaacaccagtgtaagcaatc |
51877588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 310 - 354
Target Start/End: Original strand, 4075260 - 4075304
Alignment:
| Q |
310 |
attccaagtatcaggaacaccaggcaaacaccaatgtatgcaatc |
354 |
Q |
| |
|
||||||||||||||| |||||||| | |||||||||||||||||| |
|
|
| T |
4075260 |
attccaagtatcaggcacaccagggagacaccaatgtatgcaatc |
4075304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 17 - 53
Target Start/End: Complemental strand, 5233241 - 5233205
Alignment:
| Q |
17 |
catatatggctaccattcaaaattgtaatgaaaatac |
53 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
5233241 |
catatatggctaccattaaaaattgtagtgaaaatac |
5233205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 290 - 354
Target Start/End: Complemental strand, 25340304 - 25340240
Alignment:
| Q |
290 |
aacattgcaaagaatatttgattccaagtatcaggaacaccaggcaaacaccaatgtatgcaatc |
354 |
Q |
| |
|
|||||||| || |||||||||||||| ||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
25340304 |
aacattgccaaaaatatttgattccatgtatctggaacaccaggcaaacaccaatgtatacaatc |
25340240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 310 - 355
Target Start/End: Complemental strand, 15113399 - 15113354
Alignment:
| Q |
310 |
attccaagtatcaggaacaccaggcaaacaccaatgtatgcaatca |
355 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
15113399 |
attccaagtatcaggaacaccaggcagacaccaatggctgcaatca |
15113354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University