View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14484_low_44 (Length: 336)
Name: NF14484_low_44
Description: NF14484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14484_low_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 15 - 323
Target Start/End: Complemental strand, 38187500 - 38187192
Alignment:
| Q |
15 |
tatcatcgagaagtataactatgtagctctgaaggacccacttccaagagaacttctgctgggtcagagtgagaggcaaattctgtatgatcgcgctggt |
114 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38187500 |
tatcatagagaagtataactatgtagctctgaaggacccacttccaagagaacttctgctgggtcagagtgagaggcaaattctgtatgatcgcgctggt |
38187401 |
T |
 |
| Q |
115 |
agaattattaagggagaggtaagacatgcattctatatatttattgcctcataatttgaagttgcatatcagtcttgcactaaatgccttctttgtgata |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
38187400 |
agaattattaagggagaggtaagacatgcattctatatatttattgcctcataatttcaagttgcatatcagtcttacactaaatgccttctttgtgata |
38187301 |
T |
 |
| Q |
215 |
tcactggttttatacatgatctgttaatttccctagggattcattattggnnnnnnnncaactcttaagcattatgcttttagcctttgctgttctatag |
314 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38187300 |
tcactggttttagacatgatctgttaatttccctagggattcattattggtttttgttcaactcttaagcattatgcttttagcctttgctgttctatag |
38187201 |
T |
 |
| Q |
315 |
gatgataat |
323 |
Q |
| |
|
||||||||| |
|
|
| T |
38187200 |
gatgataat |
38187192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 77; Significance: 1e-35; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 54 - 190
Target Start/End: Original strand, 38923442 - 38923578
Alignment:
| Q |
54 |
acttccaagagaacttctgctgggtcagagtgagaggcaaattctgtatgatcgcgctggtagaattattaagggagaggtaagacatgcattctatata |
153 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||| || ||||||||| |||||||||||| |||||||| |||||||| ||||||||||||| |
|
|
| T |
38923442 |
acttccaagagaacttcttctgggtcagagtgagaggcaagttgagtatgatcgtgctggtagaattgttaagggacaggtaagaaatgcattctatatc |
38923541 |
T |
 |
| Q |
154 |
tttattgcctcataatttgaagttgcatatcagtctt |
190 |
Q |
| |
|
|||||| |||| ||||| || |||||||||| |||| |
|
|
| T |
38923542 |
tttattatctcacaatttcaatttgcatatcaatctt |
38923578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University