View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14484_low_49 (Length: 327)
Name: NF14484_low_49
Description: NF14484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14484_low_49 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 72 - 283
Target Start/End: Original strand, 2065171 - 2065382
Alignment:
| Q |
72 |
tgttgtgcatgaaaatgttttaagtgtaattttgttttggtttgagaaaataggataggagagggagagggcacgtgagtggcatgtgaggaattgggtc |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2065171 |
tgttgtgcatgaaaatgttttaagtgtaattttgttttggtttgagaaaataggataggagagggagagggcacgtgagtggcatgtgaggaattgggta |
2065270 |
T |
|
| Q |
172 |
catgaattgaatgttaatggatggagttggggaaatggaatttatttgattgaatgtacagaagtaaatgtgttcaggttttttgtttaagaaagagaga |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
2065271 |
catgaattgaatgttaatggatggagttggggaaatggaatttatttgattgaatgtacagaagtaaatgcgttcaggttttttgtgtaagaaagagaga |
2065370 |
T |
|
| Q |
272 |
tacactgttcac |
283 |
Q |
| |
|
|||||||||||| |
|
|
| T |
2065371 |
tacactgttcac |
2065382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University