View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14484_low_60 (Length: 284)
Name: NF14484_low_60
Description: NF14484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14484_low_60 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 16178893 - 16179091
Alignment:
| Q |
1 |
gaaaacacgtttgcgtgaggagaatgttatgagaggatcaaatgcaaggagaggcatatcgttacggatatcgttatgttcatgaggagcttacgcctta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| ||||||||||||||||| ||||||| | |
|
|
| T |
16178893 |
gaaaacacgtttgcgtgaggagaatgttatgagaggatcaaatgcaaggagaggcatgtctttacggatatggttatgttcatgaggag--tacgcctca |
16178990 |
T |
 |
| Q |
101 |
atgtatcgctcaaaatcttgtcagaaaaatagtgatttccgtaacaaactggtctagacatgaagttgttatttctactaacaacaaggtggtgacaata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | |||||||||||||||||| |
|
|
| T |
16178991 |
atgtatcgctcaaaatcttgtcagaaaaatagtgatttccgtaacaaactggtctagacatgaagttgttttttctacttataacaaggtggtgacaata |
16179090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 239 - 267
Target Start/End: Original strand, 16179118 - 16179146
Alignment:
| Q |
239 |
agtacccacattaatttcatcgatcttca |
267 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
16179118 |
agtacccacattaatttcatcgatcttca |
16179146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University