View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14484_low_69 (Length: 251)
Name: NF14484_low_69
Description: NF14484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14484_low_69 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 2567153 - 2566919
Alignment:
| Q |
1 |
atattgtaataaagttgtgattttgggatgtttaatctcaggtgcgtaagcataaaagaattaatagaatagaacatcctatgttctacgattttttatt |
100 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2567153 |
atatcgtaataaagttgtaattttgggatgtttgatctcaggttcgtaagcataaaagaattaatagaatagaacatcctatgttctacggttttttatt |
2567054 |
T |
|
| Q |
101 |
ttgttacgtgtttaacacctcatagccgatggattaatcaaagtgtcaagaatagcgctgcagagggtgcaacagaggatttggctgccgagaatccaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2567053 |
ctgttacgtgtttaacacctcatagccgatggattaatcaaagtgtcaagaatagcgctgcagagggtgcaacagaggatttggctgccgagaatccaaa |
2566954 |
T |
|
| Q |
201 |
tccgtaagttaaagtcttacattgaatggaagaat |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
2566953 |
tccgtaagttaaagtcttacattgaatggaagaat |
2566919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University