View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14484_low_70 (Length: 251)

Name: NF14484_low_70
Description: NF14484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14484_low_70
NF14484_low_70
[»] chr5 (1 HSPs)
chr5 (14-192)||(8793630-8793809)


Alignment Details
Target: chr5 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 14 - 192
Target Start/End: Complemental strand, 8793809 - 8793630
Alignment:
14 tatgttttgattaataagcaaattttaaacatatactcctgtctttaaataattataaagtaattgatagagaaagagtataactgat-nnnnnnntatt 112  Q
    |||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||        ||||    
8793809 tatgttttgattaataagcaaattttaaacatatactcttgtcttttaataattataaagtaattgatagagaaagagtataactgataaaaaaaatatt 8793710  T
113 gtatataaaaaatcatgttgagagatatcgacctcttaaatgcatctcaatttatttagtactatgatgttaagaatgga 192  Q
     ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||    
8793709 atatataaaaaatcatgttgagagatatcgacctcttaaatgtatctcaatttatttagtactatgatgttaagagtgga 8793630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University