View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14484_low_73 (Length: 244)
Name: NF14484_low_73
Description: NF14484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14484_low_73 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 16 - 244
Target Start/End: Complemental strand, 35600335 - 35600107
Alignment:
| Q |
16 |
aatatcttttgtttgttcagtttaatagctgggtgcctgatactgtgacatctcaaaacaaaacacttattatgttcctttaatnnnnnnntaacagatt |
115 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35600335 |
aatatcatttgtttgttcagtttaatagctgggtgcctgatattgtgacatctcaaaacaaaacacttattatgttcctttaataaaaaaataacagatt |
35600236 |
T |
 |
| Q |
116 |
gaagcaatagttcaagatgccactgcagatggttttatctccagcattgatgctctcaatcttaatttggaaagccaggttataaactttcacctgccta |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35600235 |
gaagcaatagttcaagatgccactgcagatggttttatctccagcattggtgctctcaatcttaatttggaaagccaggttataaactttcacctgccta |
35600136 |
T |
 |
| Q |
216 |
catttttctgctcatcaaaaattgaattt |
244 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35600135 |
catttttctgctcatcaaaaattgaattt |
35600107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University