View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14484_low_74 (Length: 243)
Name: NF14484_low_74
Description: NF14484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14484_low_74 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 25 - 238
Target Start/End: Complemental strand, 32947705 - 32947492
Alignment:
| Q |
25 |
tattacaagcgactgtgtttaattagtacatcatcagcattgttaatagcttttgttgcacgtacatagattatcaattctttttaccaggcacattatc |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32947705 |
tattacaagcgactgtgtttaattagtacagcatcagcattgttaatagcttttgttgcacgtacatagattatcaattctttttaccaggcacattatc |
32947606 |
T |
 |
| Q |
125 |
atgacttatacgaatatccttnnnnnnntcacttatacgaataggcttttgaacaattccaaccttacgttcaataaatattcatcttttaagttgtatt |
224 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32947605 |
atgacttatacgaatatccttaaaaaaatcacttatacgaataggcttttgaacaattccaaccttacgttcaacaaatattcatcttttaagttgtatt |
32947506 |
T |
 |
| Q |
225 |
tatatattcttgga |
238 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
32947505 |
tatatatttttgga |
32947492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University