View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14484_low_84 (Length: 216)
Name: NF14484_low_84
Description: NF14484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14484_low_84 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 59 - 181
Target Start/End: Original strand, 32616058 - 32616180
Alignment:
| Q |
59 |
ttggtacacttcgtttgaatctaaaattatggattgaatctaaaatctattcttctattccataaatcgaaaatttgagtttaccaggttcttgaacata |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32616058 |
ttggtacacttcgtttgaatctaaaattatggattgaatctaaaatctattcttctattctataaatcgaaaatttgagtttaccaggttcttgaacata |
32616157 |
T |
 |
| Q |
159 |
tatgaaaattttggactcaataa |
181 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
32616158 |
tatgaaaattttggactcaataa |
32616180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University