View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14484_low_85 (Length: 216)
Name: NF14484_low_85
Description: NF14484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14484_low_85 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 114; Significance: 5e-58; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 1 - 122
Target Start/End: Complemental strand, 10888430 - 10888309
Alignment:
| Q |
1 |
acaagggttgtctgtctgtctgtgttcgtatgtctctctgaactggaagtgtttgtggtagccgggggtcggaaaaaggaaaagattttttacaatcaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10888430 |
acaagggttgtctgtctgtctgtgttcgtatgtctctctgaactggaagtgtttgtggtagccgccggtcggaaaaaggaaaagattttttacaatcaaa |
10888331 |
T |
 |
| Q |
101 |
agtcaaaacttagtacaaatat |
122 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
10888330 |
agtcaaaacttagtacaaatat |
10888309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 160 - 202
Target Start/End: Complemental strand, 10888264 - 10888222
Alignment:
| Q |
160 |
atagtactaaacttcatttttcttcacaaaagagaagtataat |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10888264 |
atagtactaaacttcatttttcttcacaaaagagaagtataat |
10888222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University