View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14484_low_92 (Length: 206)

Name: NF14484_low_92
Description: NF14484
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14484_low_92
NF14484_low_92
[»] chr3 (1 HSPs)
chr3 (8-190)||(7766556-7766738)


Alignment Details
Target: chr3 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 8 - 190
Target Start/End: Complemental strand, 7766738 - 7766556
Alignment:
8 tgagatgaaaatacatgtacatatttcaaataaaagtgcaatttagaatactttcaatttgaaatttcatagaagttatacttcgacctttgcccgctac 107  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
7766738 tgagaagaaaatacatgtacatatttcaaataaaagtgcaatttagaatattttcaatttgaaatttcatagaagttatacttcgacctttgcccgctac 7766639  T
108 ttatcactttatacaattttgtcattttaatccctgccctctcnnnnnnngttacagcgcagtgtaacaacaacacggtttga 190  Q
    |||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||    
7766638 ttatcactttatacaattttgtcattttaatccctgccctctcaaaaaaagttacagcgcagtgtaacaacaacacggtttga 7766556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University