View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14485_low_7 (Length: 257)
Name: NF14485_low_7
Description: NF14485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14485_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 18 - 241
Target Start/End: Original strand, 6486262 - 6486485
Alignment:
| Q |
18 |
tcttcgcgaaccagtgaaccgattagtgaattctgtggaggtgtgtcttcatgttgtgaccattgtggctttgagaatggtgaatttgttgtttgattcc |
117 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6486262 |
tcttcgcggaccagtgaaccaattagtgaattctgtggaggcgtgtcttcatgttgtgaccattgtggctttgagaatggtgaatttgttgtttgattcc |
6486361 |
T |
|
| Q |
118 |
atggtgacatcatcattggtgagccctcaccacttaatctgaattccaaatttcaaattaattataagttagcaacgattaattttaggatacaataaca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6486362 |
atggtgacatcatcattggtgagccctcaccacttaatctgaattccaaatttcaaattaattataagttagcaacgattaattttaggatacaataaca |
6486461 |
T |
|
| Q |
218 |
ttttatttagatttggattctctg |
241 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
6486462 |
ttttatttagatttggattctctg |
6486485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University