View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14487_high_12 (Length: 381)
Name: NF14487_high_12
Description: NF14487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14487_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 1e-91; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 1e-91
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 4859585 - 4859774
Alignment:
| Q |
1 |
tccccttcctttgttgcaaaactactggatcttcaactcaaaattcaattccttccaattacactaccactatatattttctagtctctctgagtcatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | |
|
|
| T |
4859585 |
tccccttcctttgttgcaaaactactggatctccaactcaaaattcaattccttccaattacactaacactatatattttctagtctctctgagtcatga |
4859684 |
T |
 |
| Q |
101 |
gaccccggtaatgaaatgtcaatatccaagcttttgtatgtcctgtcacggtcaccttagattcttactcttttggcttatcaaggtaata |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4859685 |
gaccccggtaatgaaatgtcaatatccaagc-tttgtatgtcctgtcacggtcaccttagattcttactcttttggcttatcaaggtaata |
4859774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 241 - 378
Target Start/End: Original strand, 4859824 - 4859960
Alignment:
| Q |
241 |
gtgaaacaacttggtacgttatttctgctctttattaatcttttatctgtgccttctggttttagtaccttatcacaaatgtccccatagaagatagatt |
340 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| ||||||||||||| || |
|
|
| T |
4859824 |
gtgagacaacttggtacgttatttctgctctttattaatcttttatttgtaccttctggttttagtaccttatcacaaatgt-cccatagaagataagtt |
4859922 |
T |
 |
| Q |
341 |
aaaaaattatatttaaatgttttatattcttcgacatc |
378 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
4859923 |
aaaaaattatatttaaatgttttatattattcaacatc |
4859960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University