View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14487_high_17 (Length: 255)
Name: NF14487_high_17
Description: NF14487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14487_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 18 - 207
Target Start/End: Complemental strand, 9769787 - 9769596
Alignment:
| Q |
18 |
agataacaagctataagaaaacaaatagaacaaaatcaatagacagaattatttcctaacaggctcttacaagtttacgagtctagaagac--aacattt |
115 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
9769787 |
agataacaagctataagaaaacaaagagaacaaaatcaatagatagaattatttcctaacaggctcttacaagtttacgagtctagaagacaaaacattt |
9769688 |
T |
 |
| Q |
116 |
tttagtaactgcaatgagttatgaaaagttgaagccgaaaacatttgttgatgcatgtcatttgattgttggtcatcttacgttattttcaa |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
9769687 |
tttagtaactgcaatgagttatgaaaagttgaagcagaaaacatttattgatgcatgttatttgattgttagtcatcttacgttattttcaa |
9769596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University