View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14487_low_17 (Length: 303)
Name: NF14487_low_17
Description: NF14487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14487_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 13 - 216
Target Start/End: Complemental strand, 39361594 - 39361389
Alignment:
| Q |
13 |
aatatgtgagactaatctcttatgctaaactcctatttgaggagtatcagatgctaaatgtgagaggctagttccttatgctaaatggttgaaaattgaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39361594 |
aatatgtgagactaatctcttatgctaaactcctatttgaggagtatcagttgctaaatgtgagaggctagttccttatgctaaatggttgaaaattgaa |
39361495 |
T |
|
| Q |
113 |
ataccaacacgcataaaataaaaaacaccaacacagtctctgactt--nnnnnnnggaagatagaacgcagtttgattgcactttaatttagtttaaaag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39361494 |
ataccaacacgcataaaataaaaaacaccaacacagtctctgtcttcaaaaaaaaggaagatagaacgcagtttgattacactttaatttagtttaaaag |
39361395 |
T |
|
| Q |
211 |
taattg |
216 |
Q |
| |
|
|||||| |
|
|
| T |
39361394 |
taattg |
39361389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 236 - 291
Target Start/End: Complemental strand, 39361353 - 39361298
Alignment:
| Q |
236 |
tattctgagttgatgagttaaaatccgatgttaaacgcagccataatccgatgttg |
291 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39361353 |
tattctcagttgatgagttaaaatccgatgttaaacgcagccataatccgatgttg |
39361298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University