View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14487_low_21 (Length: 211)
Name: NF14487_low_21
Description: NF14487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14487_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 13 - 197
Target Start/End: Complemental strand, 6489392 - 6489208
Alignment:
| Q |
13 |
agcacagaatcagacacggacaccagatacatcacggcagcagcaacaacgtcgtcaatgaatgctgtattaaattgcggttgcagtcacgaatgcggaa |
112 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6489392 |
agcacggaatcagacacggacaccagatacatcacggcagcagcaacaacgtcatcaatcaatgctgtattaaattgcggttgcagtcacgaatgcggaa |
6489293 |
T |
 |
| Q |
113 |
ctcagcaccatcaaaacggttattctcaattgaatttggatccattaaagcagattgcatctctcttctgtgacaatgaagaaac |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6489292 |
ctcagcaccatcaaaacggttattctcaattgaatttggatccattaaagcagattgcatctctcttctgtgacaatgaagaaac |
6489208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University