View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14488_high_16 (Length: 253)
Name: NF14488_high_16
Description: NF14488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14488_high_16 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 17 - 242
Target Start/End: Original strand, 10307528 - 10307753
Alignment:
| Q |
17 |
agtcacatgtgtcggtgccgtgccagtgtcgggcactgtgatgtgtctgacagccgacaatcattcaaaggaaaggcacaatgtacctatgcattactgc |
116 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10307528 |
agtcacatgtgtcggtgtcgtgccagtgtcgggcactgtgatgtgtctgacagccgacaatcattcaaaggaaaggcacaatgtacctatgcattactgc |
10307627 |
T |
|
| Q |
117 |
ccttcatatcgaaggcgtgtccgactgacatgacacggtcacatgtggattattccatattttaaaattactagtgtcgacgtgtcagtattcatgttgt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
10307628 |
ccttcatatcgaaggcgtgtccgactgacatgacaccgtcacatgtggattattccatattttaaaattactagtgtcgacgtgtcaatattcatgttgt |
10307727 |
T |
|
| Q |
217 |
gttcgatgtatgtgtcagtacttcat |
242 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
10307728 |
gttcgatgtatgtgtcagtacttcat |
10307753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University