View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14488_low_14 (Length: 260)
Name: NF14488_low_14
Description: NF14488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14488_low_14 |
 |  |
|
| [»] chr8 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 19 - 260
Target Start/End: Original strand, 26279526 - 26279765
Alignment:
| Q |
19 |
gttgaatgaatgagtcactctgtttattcgatgttgcagactataataatatggttgctaagtatcagttgtattatatcttgaaaacacatgttaaccc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26279526 |
gttgaatgaatgagtcactctgtttattcgatgttgcagactataataatatggttgctaagtatcagttgtattatatcttgaaaacacatgttaaccc |
26279625 |
T |
 |
| Q |
119 |
tttgcagtgtggaattgatgcattgcctggcatcacacatacctatctgcctgcttagagacagtgagttcagagttcctattaatatttattgttttat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26279626 |
tttgcagtgtggaattgatgcattgcctggcat--cacatacctatctgcctgctnagagacagtgagttcagagttcctattaatatttattgttttat |
26279723 |
T |
 |
| Q |
219 |
tcgatatgatgacatggaaattacttaataatgggttaattt |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26279724 |
tcgatatgatgacatggaaattacttaataatgggttaattt |
26279765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 61 - 212
Target Start/End: Complemental strand, 32590637 - 32590477
Alignment:
| Q |
61 |
ataataatatggttgctaagtatcagttgtattatatcttgaaaacacatgttaa-----------ccctttgcagtgtggaattgatgcattgcctggc |
149 |
Q |
| |
|
||||||| |||||| ||||||||||||| ||||||||||||||||||||| |||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
32590637 |
ataataagatggttactaagtatcagttttattatatcttgaaaacacattttaagtatctgttatccttttgcagcgtggaattgatgcattgcctggc |
32590538 |
T |
 |
| Q |
150 |
atcacacatacctatctgcctgcttagagacagtgagttcagagttcctattaatatttattg |
212 |
Q |
| |
|
|| ||| ||||||||||||||||||||||| ||||||| |||| |||||||||||||||||| |
|
|
| T |
32590537 |
atgaca--tacctatctgcctgcttagagacggtgagtttagagctcctattaatatttattg |
32590477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 18 - 64
Target Start/End: Complemental strand, 32591004 - 32590958
Alignment:
| Q |
18 |
agttgaatgaatgagtcactctgtttattcgatgttgcagactataa |
64 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
32591004 |
agttgaatgaatgagtcgctctgtttattcattgttgcagactataa |
32590958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University