View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14488_low_16 (Length: 253)

Name: NF14488_low_16
Description: NF14488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14488_low_16
NF14488_low_16
[»] chr6 (1 HSPs)
chr6 (17-242)||(10307528-10307753)


Alignment Details
Target: chr6 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 17 - 242
Target Start/End: Original strand, 10307528 - 10307753
Alignment:
17 agtcacatgtgtcggtgccgtgccagtgtcgggcactgtgatgtgtctgacagccgacaatcattcaaaggaaaggcacaatgtacctatgcattactgc 116  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10307528 agtcacatgtgtcggtgtcgtgccagtgtcgggcactgtgatgtgtctgacagccgacaatcattcaaaggaaaggcacaatgtacctatgcattactgc 10307627  T
117 ccttcatatcgaaggcgtgtccgactgacatgacacggtcacatgtggattattccatattttaaaattactagtgtcgacgtgtcagtattcatgttgt 216  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
10307628 ccttcatatcgaaggcgtgtccgactgacatgacaccgtcacatgtggattattccatattttaaaattactagtgtcgacgtgtcaatattcatgttgt 10307727  T
217 gttcgatgtatgtgtcagtacttcat 242  Q
    ||||||||||||||||||||||||||    
10307728 gttcgatgtatgtgtcagtacttcat 10307753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University