View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14491_low_6 (Length: 236)
Name: NF14491_low_6
Description: NF14491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14491_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 3 - 218
Target Start/End: Original strand, 4249054 - 4249269
Alignment:
| Q |
3 |
ttttccaaaaagtaagacttaatggaactccaacctaaagaggctacattgaaaacatcatttactactaatgtttcaatgtcacataacatatgataac |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4249054 |
ttttccaaaaagtaagacttaatggaactccaacctaaagaggctacattgaaaacatcatttactactaatgtttcaatgtcacataacatatgataac |
4249153 |
T |
|
| Q |
103 |
aaccacaatgatacatttcattgagatcatgaacatgtagtgaagatcgatagcttacaatactgtagatgggcggcaccagagtcacgcctttagactt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4249154 |
aaccacaatgatacatttcattgagatcatgaacatgtcgtgaagatcgatagcttacaatactgtagatgggcggcaccagagtcacgcctttagactt |
4249253 |
T |
|
| Q |
203 |
tgtggcaggcataaca |
218 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
4249254 |
tgtggcaggcataaca |
4249269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University