View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14492_high_30 (Length: 312)
Name: NF14492_high_30
Description: NF14492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14492_high_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 18 - 274
Target Start/End: Complemental strand, 39999004 - 39998748
Alignment:
| Q |
18 |
agtataaggtaggaaagacctttgcccttaaagagcacttccaatcttcaaaggtataactgactcaaatctgaaacctccggatccaagacatgtcatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39999004 |
agtataaggtaggaaagacctttgcccttaaagagcacttccaatcttcaaaggtataactgactcaaatctgaaacctccggatccaagacctgtcatt |
39998905 |
T |
|
| Q |
118 |
ttacattttaccaccaaacctaactcttggagtttgttgctcttagtctgggataggtatctgcttagacataactgatattaaccttcatattgtagtg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39998904 |
ttacattttaccaccaaacctaactcttggagtttgttgctcttagtctgggataggtatctgcttagacataactgatattaaccttcatattgtagtg |
39998805 |
T |
|
| Q |
218 |
atagcacatagctgatgctttttactccaccctccccaggttgtgttaatcttttat |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39998804 |
atagcacatagctgatgctttttactccaccctccccaggttgtgttaatcttttat |
39998748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University