View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14492_high_33 (Length: 300)
Name: NF14492_high_33
Description: NF14492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14492_high_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 16 - 282
Target Start/End: Complemental strand, 24517636 - 24517383
Alignment:
| Q |
16 |
aatatcatatattatatctagtaaggtcaacaattttactgcaagaaaccctcacagtgaaacaaatatttatttgtttcactattagagtattagagtt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| ||||||||||| || |||| | |
|
|
| T |
24517636 |
aatatcatatattatatctagtaaggtcaacaattttacggcaagaaaccctgacagtgaaacaaat-----tttgtttcactgttggagt--------t |
24517550 |
T |
 |
| Q |
116 |
ttcttgcagtaaagtttctgacctcactcaaccaattgttggaaagatgtaggtaacttatcattggtacaaagtttaatatgatgggctctatattatg |
215 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24517549 |
ttcttgcagtaaagtttctgacctcagacaaccaatcgttggaaagatgtaggtaacttatcattggtacaaagttcaatatgatgggctctatattatg |
24517450 |
T |
 |
| Q |
216 |
tggacttcgtgctattggtatggccatcttggtcgtaactgtgctaggattgagaatcagacatgta |
282 |
Q |
| |
|
|| ||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24517449 |
tgcacttcgtgcgattggtatggccatcttggtcgtaactgagctaggattgagaatcagacatgta |
24517383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 18 - 82
Target Start/End: Complemental strand, 24506373 - 24506309
Alignment:
| Q |
18 |
tatcatatattatatctagtaaggtcaacaattttactgcaagaaaccctcacagtgaaacaaat |
82 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
24506373 |
tatcatctattatatctgttaaggtcaacaattttacggcaagaaaccccgacagtgaaacaaat |
24506309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University