View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14492_high_34 (Length: 287)
Name: NF14492_high_34
Description: NF14492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14492_high_34 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 7e-49; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 16 - 150
Target Start/End: Original strand, 3319110 - 3319251
Alignment:
| Q |
16 |
cttttgcatttaatattttgtagaaatggatagcata----gcatgcatgcactattataatcatatttttctagaagatcaacaatttgtga---tctt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3319110 |
cttttgcatttaatattttgtagaaatggatagcatatatagcatgcatgcactattataatcatatttttctagaagatcaacaatttgtgatcttctt |
3319209 |
T |
|
| Q |
109 |
aataaaatgggtgtagttaatcaataactctgaaatactggt |
150 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
3319210 |
aataaaatgggtgtagttaatcggtatctctgaaatactggt |
3319251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 116
Target Start/End: Complemental strand, 3076521 - 3076456
Alignment:
| Q |
51 |
tagcatgcatgcactattataatcatatttttctagaag-atcaacaatttgtgatcttaataaaat |
116 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||| | | ||||||| |||||||||||||| |
|
|
| T |
3076521 |
tagcatgcatgcactattat-atcatattcttctagaagctttagcaatttgcgatcttaataaaat |
3076456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University